International Journal of Plant Science and Horticulture


Full Text

Research Article
An ISSR-based genetic diversity analysis of Malus sieversii in Tienshan Mountains in Xinjiang, China and Kyrgyzstan

Meiling Yang1,3, Shiyou Che2, Hong Long3, Guorong Yan3* and Weiwei Yu3*

1Institute of Surface-Earth System Science, Tianjin University, Tianjin 300071, China
2State Key Laboratory of Medicinal Chemical Biology, Nankai University, Tianjin 300071, China
3College of Horticulture and Landscape, Tianjin Agricultural University, Tianjin 300384, China

*Corresponding author: Guorong Yan, Weiwei Yu, College of Horticulture and Landscape, Tianjin Agricultural University, Tianjin 300384, China, Emails: yuweiwei20121215@163.com; yanguorong@eyou.com



Abstract: Malus sieversii constitute a valuable genetic resource in wild apple ecosystems. The aim of this study was to use inter-simple sequence repeat (ISSR) primers as an accessible tool to investigate the genetic diversity in Malus sieversii species. The experimental materials include 34 samples from Kyrgyzstan and Xinjiang of China. A total of 125 bands and 98 polymorphic bands were amplified using 47 ISSR primers. The polymorphism rate was 78.4%. The genetic similarity coefficient of Kyrgyzstan and Xinjiang of China population was 0.68; the genetic similarity coefficient of various populations in Xinjiang was 0.72~0.94. The samples in same population got into a category, but some samples in faraway geographic locations have cross clustering. Geographical isolation hindered the gene exchange of Malus sieversii in different populations for a long time, and Malus sieversii developed along the natural selection environment direction and generate genetic differentiation after that.

Keywords: Malus sieversii; ISSR; Genetic diversity

Introduction

Malus sieversii (Ledeb) Roem. is also known as Tienshan or Xinjiang wide apple, which is not only precious tertiary relict species [1], but also an important part of the world apple gene pool. Malus sieversii mainly distributed in Yili and TaCheng of XinJiang in China. In addition, kazakhatan, kyrgyzatan, tajikistan and other countries of central Asia has distribution of Malus sieversii. Early studies of Malus sieversii mainly focused on the origin and evolution [2], geographical distribution, systematic classification and so on. Among genetic diversity research, polyphenols [3,4] and fruit volatile compounds [5,6] has been studied. However, information regarding their genetic diversity remains poor.

The development of molecular markers provide a new method for screening and identification of germplasm resources. So far, SSR (Simple Sequence Repeats) [7] and RAPD (Random Amplified Polymorphic DNA) [8] technology has been applied to the genetic structure of Malus sieversii. ISSR (inter-simple sequence repeat) [9-26] is a kind of molecular marker technology with more stability and repeatability. So, ISSR was used to study the genetic diversity of Malus sieversii, which could provide theoretical basis for germplasm conservation and utilization.

Materials and Methods

The experimental materials included 34 samples representing 6 populations that distributed in Kyrgyzstan and China, which were collected from May 2012 to July 2013, including 6 materials from Balykchy and Karakol of Kyrgyzstan and 28 materials from Xinjiang of China(the geographical location of the samples sites is shown in Figure 1 and Table 1). All populations are wild ancient wild M. sieversii distribution areas, and there is no distribution of cultivated species. All samples were taken from selected trees, which we survey and make a record every year. The distance of two populations was more than 60 kilometers. Choose appropriate amount of leaves without plant diseases and insect pests and make a record of the sampled tree with GPS system. The leaves were kept in Hermetic bag with silica gel, which is replaced every two days until completely dry.

Figure 1: Distribution of M. sieversii in kyrgyzstan and China. Yili valley occupied a triangle region that distributed with M. sieversii in China, which distributed Nalati, Xinyuan, Gongliu, Daxigou populations from east to west.

Figure1

The samples were ground with PVP (Polyvinyl Pyrrolidone) and dissociated with 10%CTAB (Cetyltrimethyl Ammonium Bromide) and 0.7M NaCl in the supernatant, deposited with C2H3NaO2 (Sodium Acetate ) and precooling C3H8O (Isopropyl Alcohol). The concentration and purity of DNA were assessed with Nanodrop 2.1 and 0.8% agarose gel electrophoresis. A total of 47 ISSR primers sequences were selected on the basis of University of British Columbia Biotechnology and synthesized by BGI (Supplementary Table 1). The ISSR-PCR reaction system used in the present study followed the technique described by Weisheng[27]: Each 20μl reaction solution included 14.4μl double distilled water, 2.0μl 10×buffer (including Mg2+), 1μl primer (10nM), 1μl DNA template (200ng/μl), 0.5μl dNTPs (2.5nM), 0.1μl TaqDNA polymerase (5 units/μl). Amplification procedure were as follows: Initial denaturation at 94℃ for 5min; followed by denaturation at 94℃ for 30s, annealing at 50℃-60℃ (depending on the primer) for 1 min, extension at 72℃ for 8 min, 35cycles; 72℃ extended 7 min; Save 4℃.

Table 1: The main distribution of the 34 samples in kyrgyzstan and China.
Number Materials Location Time Elevation(m)
1 JY1 Balykchy and Karakol of kyrgyzstan 2012.7.20 1645.0
2 JY2 Balykchy and Karakol of kyrgyzstan 2012.7.20 1650.0
3 JY3 Balykchy and Karakol of kyrgyzstan 2012.7.20 1659.0
4 JY4 Balykchy and Karakol of kyrgyzstan 2012.7.20 1666.0
5 JY5 Balykchy and Karakol of kyrgyzstan 2012.7.22 1850.0
6 JY6 Balykchy and Karakol of kyrgyzstan 2012.7.22 1900.0
7 EY1 Emin in China 2012.5.7 1220.1
8 EY2 Emin in China 2012.5.7 1357.2
9 EY3 Emin in China 2012.5.7 1388.1
10 TY1 TuoLi in China 2012.5.7 888.3
11 TY2 TuoLi in China 2012.5.7 900.1
12 TY3 TuoLi in China 2012.5.7 821.6
13 TY4 TuoLi in China 2012.5.7 831.7
14 TY5 TuoLi in China 2012.5.7 841.5
15 NY1 NaLaTi in China 2012.5.4 1489.8
16 NY2 NaLaTi in China 2012.5.4 1489.5
17 NY3 NaLaTi in China 2013.4.23 1489.9
18 GY1 GongLiu in China 2012.5.4 1386.6
19 GY2 GongLiu in China 2012.5.4 1423.3
20 GY3 GongLiu in China 2012.5.4 1424.4
21 GY4 GongLiu in China 2012.5.4 1437.6
22 GY5 GongLiu in China 2012.5.4 1442.6
23 XY1 XinYuan Germplasm Nursery in China 2013.5.3 1254.5
24 XY2 XinYuan Germplasm Nursery in China 2012.5.3 1257.9
25 XY3 XinYuan Germplasm Nursery in China 2012.5.3 1338.4
26 XY4 XinYuan Germplasm Nursery in China 2012.5.3 1432.6
27 XY5 XinYuan Germplasm Nursery in China 2012.5.3 1411.2
28 XY6 XinYuan Germplasm Nursery in China 2012.5.5 1390.0
29 XY7 XinYuan Germplasm Nursery in China 2012.5.5 1456.3
30 XY8 XinYuan Germplasm Nursery in China 2012.5.5 1465.5
31 XY9 XinYuan Germplasm Nursery in China 2012.5.5 1424.4
32 W1 XinYuan Germplasm Nursery in China 2013.7.29 1932.0
34 W2 XinYuan Germplasm Nursery in China 2013.7.29 1932.0

ISSR - PCR products were test by 4% polyacrylamide gel electrophoresis with 90V voltage in 2xTBE buffer. The bands were stained with silver nitrate, and Bio-Rad Gel Imaging took photos (BIO-RAD, America). All of the above repeated three times. Clear bands were marked with “1”, and others marked with “0”. The data construct binary data matrix in Microsoft Excel, and did clustering analysis with UPGMA method of NTsys2.1 software. Genetic similarity coefficient (GS) were calculated according to the formula NXY/GS=2 (NX + NY), where NX and NY was amplified fragments number of strains X and Y,NXY is the common bands of two strains.

Results

ISSR polymorphism analysis

We identified 7 efficient ISSR primers with polymorphic from 47 ISSR primers. The criteria for selection of markers as follows: clear bands were marked with “1”, and others marked with “0”. By statistics, every primer could amplificated 9-26 bands and the average number of bands is 14. Among them, the primer (TG)8AC26 amplificated the most loci for 26. The primer (AT)8TC amplificated the least loci for 9. All amplified fragment sizes were between 200 and 1500bp. The highest percentage of polymorphic is primer (CA)8AT and (CA)8GT followed 100%. The primer CATGGTGTTGGTCATTGTTCCA polymorphic percentage is 82.3%, and a minimum of polymorphic percentage is 44.4% of (AT)8TC (Table 2). 7 primers amplificated 125 loci in total. The polymorphism loci was 98, and polymorphism percentage is 78.4%. Figure 1 showed the ISSR-PCR result of 11 Malus sieversii electrophoresis with (CA)8GT and CATGGTGTTGGTCATTGTTCCA.

Table 2: The sequences of primers and their polymorphism.
Primer sequence The number of bands Polymorphic bands The percentage of polymorphic bands
(CA)8AT 19 19 100%
(CA)8GT 17 17 100%
(AG)8T 22 12 54.5%
(AT)8TC 9 4 44.4%
(TG)8AC 26 17 65.3%
(GATA)4 15 12 80.0%
CATGGTGTTGGTCATTGTTCCA 17 14 82.3%

Figure 1: ISSR-PCR results of 11 Malus sieversii. (A) ISSR-PCR amplification results of (CA)8GT. (B) ISSR-PCR amplification results of CATGGTGTTGGTCATTGTTCCA.

Picture1

Cluster analysis results

Based on ISSR-PCR statistics, clustering analysis diagram built using NTsys2.1 software system (Figure 2). GS(Genetic similarity coefficient)of Malus sieversii is 0.68 to 1.00. Among of them, GS of JY-1 and JY-2, JY-3 and JY-6, TY-3 and TY-4, XY-5 and XY-6 is above 0.92, which revealed higher sequence homology and more close genetic relationship. Did the first hierarchy in the GS=0.71, 34 Malus sieversii germplasms were divided into two categories, the first is Malus sieversii of kyrgyzstan and the second is Malus sieversii in XinJiang of China. Did the seconed hierarchy in the GS = 0.76, different of germplasms divided into three categories. Malus sieversii of Kyrgyzstan is a separately category, and a small category included XY-7 and XY-8 in XinYuan and “The king of Malus sieversii” and GY-3 in Gong Liu. The last category is Malus sieversii of other regions. The result showed that Malus sieversii has abundant genetic variation with a variety of complex natural environment influence, especially long-term geographical isolation.

Figure 2: The dendrogram of Malus sieversii based on ISSR cluster analysis. The value on the coordinate axis is the genetic similarity coefficient, 1.00, 0.92, 0.84, 0.76 and 0.68 means 100%, 92%, 84%, 76%, 68% genetic similarity coefficient.

Figure2

Discussion

Kyrgyzstan is located in the northeast of central Asia, which east and southeast is China. Malus sieversii distributed in XinJiang of China along the Tienshan and Kyrgyzstan and Kazakhstan and so on. In this study, the results show that Malus sieversii of Kyrgyzstan and XinJiang together into their respective category, and both genetic similarity coefficient was 0.72. Genetic similarity coefficient of above is lower than that inside of population, which indicated Malus sieversii of Kyrgyzstan and XinJiang have relative relationships. These populations may be existed in a similar form before, but they produced geographical isolation after the change of geographical environment, such as the block of Tienshan. Durable geographical isolation cut off genetic exchange, which made the populations use different resources to grow and reproduce in their respective geographic areas, and occurred genetic differentiation. Therefore, to some extent, Tienshan plays a key role in enriching the genetic diversity of Malus sieversii.

Xinjiang is broad, and the distance between YiLi and TaCheng is more than 700 kilometers. In this study, the majority of samples within a region belong to a class, such as EY-2 and EY-3, TY-3 and TY-4, XY-5 and XY-6. HR from XinYuan with XY-5, XY-6 together into a category; W-1 (The oldest Malus sieversii) and W-2 (The second oldest Malus sieversii) from XinYuan respectively with GY-3 and XY-9 together into a category. Both of XinYuan and GongLiu belong to Yili region, which geographic distance is closer than that between TaCheng and Yili. So, they have more opportunities to exchange genes, and facilitated higher genetic similarity coefficient and closer relatives. TuoLi and NaLaTi respectively belong to TaCheng and YiLi prefecture and geographic distance is far, but TY-2 and NY-2 together into a category and the genetic similarity coefficient is 0.88. This result may be connected with complex environment conditions such as the spread of insects, the influence of climate and human factors. Genetic diversity reflected the difference of genetic basis and genetic improvement. High genetic diversity is the basis of maintaining the long-term survival of species [28]. The genetic similarity coefficient of all Malus sieversii resources in the study is 0.68 to 1.00, which provides a certain theoretical basis for the development and utilization of new varieties, and lay the foundation for the germplasm resources protection or utilization.

Conclusion

ISSR molecular marker showed a higher level of polymorphism genotype differences, which was suitable for genetic diversity analysis and genetic relationship of Malus sieversii. ISSR- PCR has cleared about genetic similarity coefficient of Malus sieversii in different geographical area, which was advantageous to Malus sieversii germplasm resources utilization and protection, genetic research and breeding. The clustering analysis of Malus sieversii showed that the geographical isolation block gene exchange, and made each isolated population have firmly genetic stability. So, they developed along the appropriate direction in the natural selection of environment and rich genetic diversity all the time (Supplementary Table 1).

Supplementary Table 1: ISSR Primer Sequences
No. Number Primer Sequences Tm
ISSR1 UBC 846 CA CA CA CA CA CA CA CAAT 54℃
ISSR2 UBC 846 CA CA CA CA CA CA CA CAGT 56℃
ISSR3 UBC 847 AGAGTTGGTAGCTCTTGATC 53℃
ISSR4 UBC 834 AG AG AG AG AG AG AG AGGT 54℃
ISSR5 UBC 801 AT AT AT AT AT AT AT ATT 36℃
ISSR6 UBC 802 AT AT AT AT AT AT AT ATG 38℃
ISSR7 UBC 803 AT AT AT AT AT AT AT ATC 38℃
ISSR8 UBC 804 TA TA TA TA TA TA TA TAA 36℃
ISSR9 UBC 805 TA TA TA TA TA TA TA TAC 36℃
ISSR10 UBC 806 TA TA TA TA TA TA TA TAG 36℃
ISSR11 UBC 807 AG AG AG AG AG AG AG AGT 50℃
ISSR12 UBC 808 AG AG AG AG AG AG AG AGC 52℃
ISSR13 UBC 809 AG AG AG AG AG AG AG AGG 52℃
ISSR14 UBC 810 GA GA GA GA GA GA GA GAT 50℃
ISSR15 UBC 811 GA GA GA GA GA GA GA GA C 52℃
ISSR16 UBC 812 GA GA GA GA GA GA GA GAA 50℃
ISSR17 UBC 813 CT CT CT CT CT CT CT CTT 50℃
ISSR18 UBC 815 CT CT CT CT CT CT CT CTG 52℃
ISSR19 UBC 821 CA CA CA CA CA CA CA CAT 50℃
ISSR20 UBC 828 TG TG TG TG TG TG TG TGA 50℃
ISSR21 UBC 829 TG TG TG TG TG TG TG TGC 52℃
ISSR22 UBC 830 TG TG TG TG TG TG TG TGG 52℃
ISSR23 UBC 832 AT AT AT AT AT AT AT ATTC 38℃
ISSR24 UBC 833 AT AT AT AT AT AT AT ATTG 38℃
ISSR25 UBC 840 GA GA GA GA GA GA GA GATT 52℃
ISSR26 UBC 847 CA CA CA CA CA CA CA CAGC 56℃
ISSR27 UBC 851 GT GT GT GT GT GT GT GTCG 56℃
ISSR28 UBC 854 TC TC TC TC TC TC TC TCAG 54℃
ISSR29 UBC 855 AC AC AC AC AC AC AC ACCT 52℃
ISSR30 UBC 856 AC AC AC AC AC AC AC ACTA 52℃
ISSR31 UBC 857 AC AC AC AC AC AC AC ACCG 56℃
ISSR32 UBC 858 TG TG TG TG TG TG TG TGAG 54℃
ISSR33 UBC 859 TG TG TG TG TG TG TG TGAC 54℃
ISSR34 UBC 855 TG TG TG TG TG TG TG TGAA 52℃
ISSR35 UBC 861 ACC ACC ACC ACC ACC 50℃
ISSR36 UBC 862 AGC AGC AGC AGC AGC 50℃
ISSR37 UBC 863 AGT AGT AGT AGT AGT 40℃
ISSR38 UBC 864 ATG ATG ATG ATG ATG 40℃
ISSR39 UBC 865 CCG CCG CCG CCG CCG 60℃
ISSR40 UBC 866 CTC CTC CTC CTC CTC 50℃
ISSR41 UBC 872 GATA GATA GATA GATA 40℃
ISSR42 UBC 874 CCCT CCCT CCCT CCCT 56℃
ISSR43 UBC 875 CTAG CTAG CTAG CTAG 48℃
ISSR44 UBC 876 GATA GATA GATA GATA 40℃
ISSR45 UBC 892 TAGATCTGATATCTGAATTCC 50℃
ISSR46 UBC 899 CATGGTGTTGGTCATTGTTCCA 56℃
ISSR47 UBC900 ACTTCCACAGGTTAACACA 47℃


References
  1. Zhang Xinshi. 1973. Ecological geographical characteristics and community problems of Yili wild fruit forest. Acta Botanica sinica. 2: 239-253.[Ref.]
  2. Harris S A, Robinson J P, et al. 2002. Genetic clues to the origin of the apple. Trends in Genetics. 8: 426-430. [Ref.]
  3. Zhang Xiaoyan, Chen Xuesen, Peng Yong, et al. 2008. Genetic diversity of phenolic compounds in Malus sieversii. Acta Horticultural Sinica. 9: 1351-1356.[Ref.]
  4. Feng Tao, Zhang Hong, Chen Xuesen, et al. 2006. Genetic Diversity of Fruit Morphological Traits and Content of Mineral Element in Malus sieversii (Ldb .)Roem. and its Elite Seedlings. Journal of Plant Genetic Resources. 7: 270-276.[Ref.]
  5. Chen Xuesen, Feng Tao, Zhang Yanmin, et al. 2007. Genetic Diversity of Volatile Components in Xinjiang Wild Apple (Malus sieversii). Journal of Genetics and Genomics. 2: 171-179.[Ref.]
  6. Qin Wei, Liao Kang, Geng Wenjuan, et al. 2010. Genetic diversity of mineral elements in pollens of Malus. Sieversii and some cultivars in Xinjiang. Nonwood Forest Research. 28.[Ref.]
  7. Qin Wei, Sha Hong, Liu Liqiang, et al. 2012. SSR analysis for genetic diversity of Malus sieversii from Xinjiang, China. Journal of Fruit Science. 29: 161-165.[Ref.]
  8. Zhang Chunyu, Chen Xuesen, Lin Qun, et al. 2009. SRAP Markers for Population Genetic Structure and Genetic Diversity in Malus sieversii from Xinjiang, China. Acta Horticultural Sinica. 36: 7-14.[Ref.]
  9. ZhaoQian, Du hong, Zhuang Donghong, et al. 2008. Genetic Relationships Analysis of 14 Cultivars of Phalaenopsis hybrid Based on ISSR Molecular Markers. Bulletin of Botanical Research. 28: 227-231.[Ref.]
  10. Miao Hengbin, Chen Fadi, Zhao Hongbo. 2007. Genetic relationship of 85 Chrysanthemum (Dendranthema ×grandiflora (Ramat.) Kitamura) cultivars revealed by ISSR Analysis. Acta Horticultural Sinica. 34: 1243-1248.[Ref.]
  11. Liu Benying, Sun Xuemei, Li Youyong, et al. 2009. Analysis of Genetic Diversity of Tea Plants by Using EST-SSR and ISSR Markers. Chinese journal of tropical crops. 30: 1577-1583.[Ref.]
  12. Luo Xiaoying, Zhuang Xueying, Yang Yuesheng. 2007. Genetic Diversity of Camellia changii Ye (Theaceae) Using ISSR Markers. Journal of Tropical and Subtropical Botany. 15: 93-100.[Ref.]
  13. Guo Changkui, Li Jiang, Li Wensheng. 2010. Identification and Genetic Relationships of an ISSR marker for Fuji Sport and main Cultivars of Apple Planted in Xinjiang. Journal of Xinjiang Agricultural University. 33: 105-108.[Ref.]
  14. Liang Jingxia, Qi Jianmin, Fang Pingping, et al. 2008. Genetic diversity and genetic relationship analysis of Tobacco germplasm based on Inter-Simple Sequence Repeat (ISSR). Scientia Agricultura Sinica. 41: 286-294.[Ref.]
  15. Liu Benying, Li Youyong, Tang Yichun, et al. 2010. Genetic Diversity and Relationship of Tea Germplasm in Yunnan Revealed by ISSR Analysis. Acta Agronomica sinica. 36: 391-400.[Ref.]
  16. Jin Zexin, Li Junmin. 2007. ISSR analysis on genetic diversity of endangered relic shrub Sinocalycanthus chinensis. Chinese Journal of Applied Ecology. 18: 247-253.[Ref.]
  17. Yohannes Petros, Arnulf Merker, Habtamu Zeleke. 2008. Analysis of genetic diversity and relationships of wild Guizotia species from Ethiopia using ISSR markers. Genet Resour Crop Evol. 55: 451-458.[Ref.]
  18. Fernandez M E, Figueiras A M, Benito C. 2002. The use of ISSR and RAPD markers for detecting DNA polymorphism, genotype identification and genetic diversity among barley cultivars with known origin. Theor Appl Genet. 104: 845-851.[Ref.]
  19. Patzak J. 2001. Comparison of RAPD, STS, ISSR and AFLP molecular methods used for assessment of genetic diversity in hop (Humulus lupulus L.). Euphytica. 121: 9-18.[Ref.]
  20. Argade NC, Tamhankar SA, Karibasappa GS, et al. 2009. DNA Profiling and Assessment of Genetic Relationships Among Important Seedless Grape (Vitis vinifera) Varieties in India Using ISSR Markers. Journal Plant Biochemistry and Biotechnology. 18: 45-51. [Ref.]
  21. Yasodha R, Kathirvel M, Sumathi R, et al. 2004. Genetic analyses of Casuarinas using ISSR and FISSR markers. Genetica. 122: 161-172.[Ref.]
  22. Joshi SP, Gupta VS, Aggarwal RK, et al. 2000. Genetic diversity and phylogenetic relationship as revealed by inter simple sequence repeat (ISSR) polymorphism in the genus Oryza. Theoretical and Applied Genetics. 100: 1311-1320.[Ref.]
  23. Huang JC, Sun M. 2000. Genetic diversity and relationships of sweetpotato and its wild relatives in Ipomoea series Batatas(Convolvulaceae) as revealed by inter-simple sequence repeat (ISSR) and restriction analysis of chloroplast DNA. Theoretical and Applied Genetics. 100: 1050-1060.[Ref.]
  24. Kar PK, Srivastava PP, Awasthi AK, et al. 2008. Genetic variability and association of ISSR markers with some biochemical traits in mulberry (Morus spp.) genetic resources available in India. Tree Genetics and Genomes. 4: 75-83.[Ref.]
  25. Ammiraju JSS, Dholakia BB, Santra DK, et al. 2001. Identification of inter simple sequence repeat (ISSR) markers associated with seed size in wheat. Theoretical and Applied Genetics. 102: 726-732.[Ref.]
  26. Fernández M, Figueiras A, Benito C. 2002. The use of ISSR and RAPD markers for detecting DNA polymorphism, genotype identification and genetic diversity among barley cultivars with known origin. Theoretical and Applied Genetics. 104: 845-851.[Ref.]
  27. Liu, Weisheng, Feng, et al. 2005. Optimization of ISSR reaction system and construction of cultivar fingerprint in apricot. Journal of Fruit Science. 22: 626-629.[Ref.]
  28. Xu Shiping, Guo Lixiu, Weng Kenan, et al. 2005. Pressure Induced Rice Mutation and ISSR Analysis of the Mutants. Chinese Journal of High-Pressure Physics. 19: 305-311.[Ref.]


Download Provisional PDF Here



Article Information

Aritcle Type: Research Article

Citation: Meiling Y, Shiyou C, Hong L, et al. 2019. An ISSR-based genetic diversity analysis of Malus sieversii in Tienshan Mountains in Xinjiang, China and Kyrgyzstan. Int J Plant Sci Hor. 1: 40-48.

Copyright:This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Copyright © 2019; Meiling Y

Publication history: 

  • Received date: 31 December 2018

  • Accepted date: 08 January 2019

  • Published date: 09 January 2019